Preparation and antihypertensive activity of peptides from Porphyra yezoensis
نویسندگان
چکیده
This research was to develop a antihypertensive peptide, an efficient angiotensin converting enzyme (ACE) inhibitor (ACEI), from Porphyra yezoensis. Seven commercial enzymes were screened and then enzymatic hydrolysis conditions were optimised. The results showed that alcalase was the most effective for hydrolysis and its optimum conditions for achieving the highest antihypertensive activity of peptide were 1.5% substrate, 5% alcalase, pH 9.0, and temperature of 50 C at a hydrolysis time of 60 min. The antihypertensive peptide produced under the optimum conditions had a high ACE inhibition rate of 55.0% and a low IC50 value of 1.6 g/l and remained at high stability at temperatures of 4, 25, and 37 C, pH values of 2.0 and 8.0, and after pepsin and trypsin treatments. Major proteins from P. yezoensis were glutelin, albumin, and gliadin. The albumin and glutelin had higher hydrolysis rates than the gliadin, but the IC50 value of glutelin was the lowest, which indicated that the antihypertensive peptide from glutelin was more functional. 2010 Elsevier Ltd. All rights reserved.
منابع مشابه
Comparative Analysis of MicroRNAs between Sporophyte and Gametophyte of Porphyra yezoensis
Porphyra yezoensis Ueda is an intertidal marine red algae that has received increasing attention as a model organism owing to its important role in biological research and the agronomic industry. The two generations of Porphyra yezoensis, the sporophyte and the gametophyte, have the same genome but show great differences in many aspects, including structural features, habitat, and gene expressi...
متن کاملActivation of the mTOR signaling pathway in breast cancer MCF-7 cells by a peptide derived from Porphyra yezoensis
Seaweeds have beneficial nutritional and medicinal properties. Several studies have examined the polysaccharides found in the extracts of Porphyra yezoensis (PPY), although the effects of particular proteins have not been reported, and peptides from the marine alga PPY function in antitumor cell signaling, although the precise mechanism is not well understood. Apoptosis plays an important role ...
متن کاملIdentification of miRNA from Porphyra yezoensis by High-Throughput Sequencing and Bioinformatics Analysis
BACKGROUND miRNAs are a class of non-coding, small RNAs that are approximately 22 nucleotides long and play important roles in the translational level regulation of gene expression by either directly binding or cleaving target mRNAs. The red alga, Porphyra yezoensis is one of the most important marine economic crops worldwide. To date, only a few miRNAs have been identified in green unicellar a...
متن کاملIsolation of porphyran-degrading marine microorganisms from the surface of red alga, Porphyra yezoensis.
Marine microorganisms degrading porphyran (POR) were found on the surface of thalli of Porphyra yezoensis. Fifteen crude microorganism groups softened and liquefied the surface of agar-rich plate medium. Among these, 11 microorganism groups degraded porphyran that consisted of sulfated polysaccharide in Porphyra yezoensis. Following isolation, 7 POR-degradable microorganisms were isolated from ...
متن کاملThe nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.
The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).
متن کامل